This manuscript offers valuable insights by identifying two distinct liver cancer subtypes through multi-omics integration and developing a robust prognostic model, validated across various datasets, ...

Background and objective Gastric cancer (GC) remains a prevalent and preventable disease, yet accurate early diagnostic ...

The future of genotyping is characterized by its expanding impact across medicine, research, agriculture, and personal decision-making.

Department of Occupational and Environmental Health, School of Public Health, Department of Radiation and Medical Oncology, Zhongnan Hospital of Wuhan University, Wuhan University, Wuhan 430071, China ...

R-loops can help to turn on specific genes by forming an RNA:DNA "sandwich" in regulatory regions of a target gene. In the case of the NPAS4 gene, R-loops appear to help to bring the enhancer ...

In living organisms, DNA expression occurs sequentially: Genes are transcribed into RNA, which is translated ... (In nature, the sequence of bases codes for a gene.) For example, two inputs ...

Milenkovic. The study was possible thanks to a new technology called nanopore direct RNA sequencing, which permits the direct analysis of rRNA molecules with all its modifications. "It allows us ...

CD Genomics employs cutting-edge technologies such as microarray-based SNP analysis and next-generation sequencing (NGS) to deliver high-throughput and accurate genotyping results. Microarray ...

This single cell contains a kind of instruction manual, DNA, made up of around 3 billion letters ... whether administering the eight amino acids encoded in the sequence GCAAGGACATATGGGCGAAGGAGA can ...

Methods: RNA sequencing was used to analyze the expression profiles of circRNAs in glioma tissues and normal brain tissues. Quantitative real-time polymerase chain reaction was implemented to examine ...